Reverse Transcription:Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.
SYBR Green Assay:Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.
Electron Microscopy:Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.
Quantitative RT-PCR:Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.
Negative Control:Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.
Control:Article Title: Bmp9 regulates Notch signaling and the temporal dynamics of angiogenesis via Lunatic Fringe.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat# 10270-106 DMEM, High Glucose Gibco Cat# 11965092 Trypsin-EDTA (0.05%), phenol red Gibco Cat# 25300062 Penicillin-Streptomycin Gibco Cat# 22571038 PBS (10X), pH 7.4 Gibco Cat# 70011051 iScript Reverse Transcription Supermix Bio Rad Cat# 1708840 iQ SYBR Green Supermix Bio Rad Cat# 1708880 BJ Fibroblasts ATCC Cat# CRL-2522 HEK-293 Cells ATCC Cat# CRL-1573 HUVECs Promocell Cat# C-12203 EGM-2 Endothelial Cell Growth Medium-2 BulletKit Lonza Cat# CC-3162 Endothelial Cell Basal Medium 2 Promocell Cat# C-22211 Pericyte Growth Medium 2 Promocell Cat# C-28041 Human Pericytes Promocell Cat# C-12980 FluoroshieldTM with DAPI Sigma-Aldrich Cat# F6057 Paraformaldehyde 16% Electron Microscopy Sciences Cat# 15710 Trypan Blue Solution, 0.4% Gibco Cat# 15250061 Fugene HD Promega Cat# E2311 Cycloheximide, 95% Sigma-Aldrich Cat# 01810 qRT-PCR Primers and siRNA Hs_HEY1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_HES1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_RFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_MFNG_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACTB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_ACVRL1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PDGFRB_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_CDH5_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_PECAM1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hes1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Hey1_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Lfng_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Mm_Actb_1_SG QuantiTect Primer Assay Qiagen Cat# 249900 Hs_LFNG_10 FlexiTube siRNA Qiagen Cat# 1027417 Hs_ACVRL1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_JAG1_5 FlexiTube siRNA Qiagen Cat# 1027417 Hs_DLL4_5 FlexiTube siRNA Qiagen Cat# 1027417 AllStars Negative Control siRNA Qiagen Cat# 1027280 Control morpholino oligonucleotide: 5’- CCTCTTACCTCAGTTACAATTTATA -3’ Gene Tools Cat# 2934999000 lfng morpholino oligonucleotide: 5’- ACCGTGTATACCTGTCGCATGTTTC -3’ Gene Tools ID# ZDB-MRPHLNO-100510-10 Plasmids pReceiver-Lv205-hLFNG Genecopoeia Cat# EX-H1563-LV205-GS pReceiver-LV205 Genecopoeia Cat# EX-Neg-LV205 pLV-mCherry Addgene Cat# 36084; RRID: Addgene_36084 pRSV-Rev Addgene Cat# 12253; RRID: Addgene_12253 pCMV-VSV-G Addgene Cat# 8454; RRID: Addgene_8454 (Continued on next page) Developmental Cell 61, 1–17.e1–e9, April 8, 2026 e2 .. Tamoxifen-inducible Cdh5-CreErt2 and acvrl1 loxP mice were kindly provided by Ralf Adams and S. Paul Oh respectively, and were back-crossed to C57/Bl6 background (Charles River) for 10 generations.
|
ATCC is a verified supplier 
ATCC manufactures this product 